DESAIN PRIMER SPESIFIK DARI PENANDA atpF-atpH SECARA IN SILICO UNTUK DETEKSI TUMBUHAN LANGKA

    Liana Agustine, - and Topik Hidayat, - and Hernawati, - (2025) DESAIN PRIMER SPESIFIK DARI PENANDA atpF-atpH SECARA IN SILICO UNTUK DETEKSI TUMBUHAN LANGKA. S1 thesis, Universitas Pendidikan Indonesia.

    Abstract

    Keanekaragaman hayati tumbuhan memegang peran krusial dalam menjaga keseimbangan ekosistem global. Adanya peningkatan beragam ancaman dapat memperbesar risiko kelangkaan bahkan kepunahan spesies tumbuhan, sehingga deteksi cepat dan akurat sangat diperlukan untuk upaya konservasi dini. Penelitian ini bertujuan menghasilkan primer spesifik dari penanda atpF-atpH yang dirancang secara in silico sebagai alat potensial untuk mendeteksi tumbuhan langka. Pemanfaatan penanda deoxyribonucleic acid (DNA), khususnya sekuens pendek pada genom kloroplas yang mencakup wilayah atpF-atpH, menunjukkan potensi dalam mengidentifikasi keragaman genetik hingga tingkat spesies. Metode DNA barcoding dalam studi ini dikembangkan secara bioinformatika (in silico), memanfaatkan software seperti ClustalX, BioEdit, dan FastPCR. Software ini digunakan untuk mendesain primer, melakukan uji coba reaksi PCR secara in silico, dan menguji efektivitas primer. Hasil penelitian ini menunjukkan bahwa primer forward ID 1:F 843-862 (5’–accgatattttagcaacaaa–3’) dari penanda atpF-atpH memiliki potensi signifikan untuk mendeteksi tumbuhan langka dan memiliki tingkat akurasi mencapai 95%. Penemuan ini memberikan informasi penting mengenai potensi primer spesifik penanda atpF-atpH yang dikembangkan secara in silico sebagai alat deteksi dini dan mendukung penerapan strategi konservasi tumbuhan langka di masa depan. Kata kunci: atpF-atpH; Desain primer; DNA barcode; In silico; Tumbuhan Langka Plant biodiversity plays a crucial role in maintaining global ecosystem balance. The increasing array of threats significantly escalates the risk of plant species rarity and even extinction, necessitating rapid and accurate detection for early conservation efforts. This research aims to develop specific primers from the atpF-atpH marker, designed in silico as a potential tool for detecting rare plants. The utilization of deoxyribonucleic acid (DNA) markers, particularly short sequences within the chloroplast genome encompassing the atpF-atpH region, demonstrates considerable potential in identifying genetic diversity down to the species level. The DNA barcoding method in this study was developed bioinformatically (in silico), leveraging software such as ClustalX, BioEdit, and FastPCR. These tools were employed for designing primers, conducting in silico PCR reaction trials, and evaluating primer effectiveness. The results of this study indicate that the forward primer ID 1:F 843-862 (5’–accgatattttagcaacaaa–3’) derived from the atpF-atpH marker possesses significant potential for detecting rare plants, achieving an accuracy level of 95%. This finding provides important information regarding the potential of specific atpF-atpH primers developed in silico as an early detection tool and supports the implementation of future rare plant conservation strategies.

    [thumbnail of S_BIO_2109240_Title.pdf] Text
    S_BIO_2109240_Title.pdf

    Download (533kB)
    [thumbnail of S_BIO_2109240_Chapter1.pdf] Text
    S_BIO_2109240_Chapter1.pdf

    Download (249kB)
    [thumbnail of S_BIO_2109240_Chapter2.pdf] Text
    S_BIO_2109240_Chapter2.pdf
    Restricted to Staf Perpustakaan

    Download (637kB)
    [thumbnail of S_BIO_2109240_Chapter3.pdf] Text
    S_BIO_2109240_Chapter3.pdf

    Download (2MB)
    [thumbnail of S_BIO_2109240_Chapter4.pdf] Text
    S_BIO_2109240_Chapter4.pdf
    Restricted to Staf Perpustakaan

    Download (970kB)
    [thumbnail of S_BIO_2109240_Chapter5.pdf] Text
    S_BIO_2109240_Chapter5.pdf

    Download (155kB)
    Official URL: https://repository.upi.edu/
    Item Type: Thesis (S1)
    Additional Information: ID SINTA Dosen Pembimbing: Topik Hidayat: 256954 Hernawati: 6005188
    Uncontrolled Keywords: atpF-atpH, Desain primer, DNA barcode, In silico, Tumbuhan Langka. atpF-atpH, DNA barcode, In silico, Primer design, Rare plants.
    Subjects: Q Science > QK Botany
    S Agriculture > S Agriculture (General)
    Divisions: Fakultas Pendidikan Matematika dan Ilmu Pengetahuan Alam > Program Studi Biologi - S1
    Depositing User: Liana Agustine
    Date Deposited: 13 Aug 2025 10:06
    Last Modified: 13 Aug 2025 10:06
    URI: http://repository.upi.edu/id/eprint/135430

    Actions (login required)

    View Item View Item